CNN's Ed Lavandera is on the ground as police tear down Pro-Palestinian protesters' barrier at the University of Texas Austin....
barrier
“Studying marine conservation is hard. Marine ecosystems are degrading. Coral reefs are bleaching: by 2060, without significant emissions reductions, mass...
The Justice Department on Monday filed suit against the State of Texas over its installation of a floating barrier meant...
Texas Gov. Greg Abbott has no plans to take down a floating barrier his government installed in the Rio Grande,...
See floating barrier to deter migrant crossings along US-Mexico border Texas is facing a lawsuit against its installation of a...
Some people use cards with phonetic symbols to help them learn English.Credit: Peng Song/Getty Researchers whose first language is not...
'Shameful!': Texas lawmaker slams Abbott's latest immigration plan Rep. Veronica Escobar (D-TX) reacts to Republican Texas Gov. Greg Abbott's plan...
Police have arrested the driver of a U-Haul who crashed into a security barrier in Lafayette Square near the White...
Video captures moment young boy dropped from barrier wall Surveillance video captured the moment a 4-year-old boy was dropped from...
DNA constructs for use as substrates in the cohesin diffusion assayDNA fragments containing a single HighOc1 CTCF-binding site51 (TCAGAGTGGCGGCCAGCAGGGGGCGCCCTTGCCAGA) were...