DNA constructs for use as substrates in the cohesin diffusion assayDNA fragments containing a single HighOc1 CTCF-binding site51 (TCAGAGTGGCGGCCAGCAGGGGGCGCCCTTGCCAGA) were...
barrier
See the technique that could help save the Great Barrier Reef Researchers in Australia are testing a technique called "coral...
Chu, C., Artis, D. & Chiu, I. M. Neuro-immune interactions in the tissues. Immunity 52, 464–474 (2020).CAS PubMed Google Scholar ...
CNN — A woman dressed in black raises a framed portrait of her son, Siavash Mahmoudi, in the air as...
A utility player for the powerhouse Yankees of the 1960s, he was named manager of the Triple-A Buffalo Bisons, becoming...
From not knowing any English to becoming a starter and then having to live with his mother, Younghoe Koo is...
Now, Koo is the second-highest paid kicker in the league having signed a five-year contract extension with the Atlanta Falcons...
Mayor Adams marked the completion Monday of another link in the chain of storm surge barriers along the East Side...
Barrier islands protect the coastline from storms, storm surge, waves and flooding. They can act as a buffer between the...
Researchers at the Harvard John A. Paulson School of Engineering and Applied Sciences (SEAS), in collaboration with colleagues at the...