TLR7 gain-of-function genetic variation causes human lupus – Nature

Mice

Mice were bred and maintained in specific-pathogen-free conditions at the Australian National University (ANU), Canberra, Australia. Experimentation was performed according to the regulations approved by the local institution ethics committee, including the Australian National University’s Animal and human Experimentation Ethics Committee. Estimations of the expected change between experimental and control groups allowed the use of power analysis to estimate the group size that would enable detection of statistically significant differences. For in vitro experiments, randomization was not required given that there were no relevant covariates. Blinding was used for microscopy: histological analysis, electron microscopy imaging. Mice were used from 6–12 weeks, except for survival curves and tissue assessment (12–26 weeks). Both male and female mice were used and their genders are indicated in most figures (the Y chromosome is indicated in the genotype, that is, male mice).

Generation of the Tlr7- and Rnaseh2b-mutant mouse strains

Tlr7^Y264H and deficient mice as well as Rnaseh2b-deficient knockout mice were generated in a C57BL/6NCrL background using CRISPR–Cas9-mediated gene editing technology⁴⁵. Genomic sequences were obtained from Ensembl (https://ensembl.org/) and compared to ascertain the conservation of the sequences between mouse and human genes. Single guide RNA (sgRNA) and single-stranded oligonucleotides were purchased from Integrated DNA Technology with the following sequences: Tlr7^Y264H sgRNA, 5′-TATGGGACATTATAACATCG-3′ with a 5′-AGG-3′ PAM; Rnaseh2b 5′-CTTTTAGTGCCACCACAGTT-3′ with a 5′-TGG-3′ PAM; Tlr7^Y264H single-stranded oligonucleotide: 5′- GTCAATGAATTGAAAGCATTGTCATGGATCTGTAAGGGGGAATTATTTTCACACGGTGTACACGGATATGGGACATTATGACATCGAGGGCAATTTCCACTTAGGTCAAGAACTTGCAACTCATTGAGGTTATTAAAATCATTTTCTTGGATTTTCTTAAT-3′. The italicized nucleotides in the sgRNA sequences indicate the base altered by the respective variant in Tlr7 or Rnaseh2b.

C57BL/6Ncrl female mice (aged 3–4 weeks) were mated with C57BL/6Ncrl males. Pseudopregnant CFW/crl mice were superovulated and mated with stud males. After detection of a vaginal plug, the fertilized zygotes were collected from the oviduct and Cas9 protein (50 ng µl⁻¹) was co-injected with a mixture of sgRNA (2.5 ng µl⁻¹) and single-stranded oligonucleotides (50 ng µl⁻¹) into the pronucleus of the fertilized zygotes. After the micro-injection of the eggs, the zygotes were incubated overnight at 37 °C under 5% CO₂ and two-cell stage embryos were surgically transferred into the uterine horn of the pseudopregnant CFW/Crl mice. The primers designed to amplify these regions are as follows: Tlr7–Y264H-F, 5′-TGAAACACTCTACCTGGGTCA-3′; Tlr7–Y264H-R, 5′-GCCTCCTCAATTTCTCTGGC-3′; Rnaseh2b-F, 5′-GCAAGACCATCCCTACTCCA-3′;and Rnaseh2b-R,5′-AACACCTGCCCACATCTGTA-3′.

Human WES and variant identification

Written informed consent was obtained as part of the Centre for Personalised Immunology Program. The study was approved by and complies with all relevant ethical regulations of the Australian National University and ACT Health Human Ethics Committees, the University Hospitals Institutional Review Board, or by the Renji Hospital Ethics Committee of Shanghai Jiaotong University School of Medicine. For WES analysis, DNA samples were enriched using the Human SureSelect XT2 All Exon V4 Kit and sequenced using the Illumina HiSeq 2000 (Illumina) system. Bioinformatics analysis was performed at JCSMR, ANU as previously described⁴⁵. A search for ‘de novo’, coding, novel or ultrarare (MAF < 0.0005) variants among 100 SLE trios identified a proband with a de novo, novel variant in TLR7 (Y64H) (family A). A further search for rare variants (MAF < 0.005) in TLR7 across our three systemic autoimmune cohorts (Australia, Europe and China) that have undergone WES at our Centre for Personalised Immunology (~500 probands) identified 2 additional probands (families B–C). A further proband was identified at Baylor-Hopkins Center for Mendelian Genomics, where the family was recruited as a part of a study investigating monogenic causes of neuroimmune disorders in families with early disease onset (≤10 years). All family members provided written informed consent under Baylor College of Medicine Institutional Review Board (IRB) protocol H-29697. A detailed description of the exome sequencing approach, data processing, filtration and analysis for that particular family can be found in the supplementary information of ref. ⁴⁶. All probands were subsequently analysed for rare variants in 22 genes proven to cause human SLE (Supplementary Table 1).

Human PBMC preparation

PBMCs were isolated using Ficoll-Paque (GE Healthcare Life Sciences) gradient centrifugation and frozen in fetal bovine serum (FBS, Gibco) with 10% DMSO (Sigma-Aldrich).

Flow cytometry

Single-cell suspensions were prepared from mouse spleens or thawed PBMCs, and individual subsets were analysed using flow cytometry. The primary antibodies used for mouse tissues included: SiglecH-APC (551, BioLegend), IgD-FITC (405718, BioLegend), IgD-PerCP Cy5.5 (11-26c.2a, BD Pharmingen), CD3-A700 (17A2, BioLegend), CD19-BUV395 (1D3, BD Horizon), CD138-PE (281-2, BD Pharmingen), PD1-BV421 (29F.1A12, BioLegend), CCR7-PerCP Cy5.5 (4B12, BioLegend), CD8-BUV805 (53-6.7, BD Horizon), CD19-BV510 (6D5, BioLegend), CD4-BUV395 (6K1.5, BD Horizon) CD21/35-BV605 (7G6, BD Horizon), CD45.1-BV605 (A20, BioLegend), CD45.1-BV711 (A20, BioLegend), CD45.1-PB (A20, BioLegend), TLR7-PE (A94B10, BD Pharmingen), CD23-BV421 (B3B4, BioLegend), CXCR3-PE (CXCR3-173, BioLegend), CD19-A700 (eBio1D3, Invitrogen), FOXP3-FITC (FJK-16s, Invitrogen (eBioscience), FOXP3-PECy7 (FJK-16s, Invitrogen eBioscience), IgM-FITC (II/41, BD Pharmingen), IgM-PECy7 (II/41, Invitrogen), CD44-FITC (IM7, BD Pharmingen), CD44-PB (IM7, BioLegend), CD95 (FAS)-BV510 (Jo2, BD Horizon), BCL6-A467 (K112-91, BD Pharmingen), CD11b-PerCP Cy5.5 (M1/70, BioLegend), IA/IE-BV421 (M5/114.15.2, BioLegend), CD11c-A647 (N418, BioLegend), CD11c-BV510 (N418, BioLegend), CD11c-FITC (N418, BioLegend), CD25-PE (PC62, BioLegend), B220-A647 (RA3-6B2, BD Pharmingen), B220-BUV395 (RA3-6B2, BD Horizon), B220-BUV737 (RA3-6B2, BD Horizon), CD98-PECy7 (RI.388, BioLegend), CD4-PECy7 (RM4-5, BD Pharmingen), CD25-A647 (PC61, BioLegend), CD4-A647 (RM4-5, BioLegend), CD11c-APC (HL3, BD Pharmingen), CD138-Biotin (281-2, BD Bioscience), CXCR5-Biotin (2G8, BD Bioscience), streptavidin-BUV805 (BD Horizon), streptavidin-BV510 (BioLegend), CD19-BV605 (6D5, BioLegend), B220-PE (RA3-6B2, BioLegend), BST2-PE (927, BioLegend), CD19-PE (6D5, BioLegend), IgD-PE (11-26c.2a, BioLegend), CD11b-PECy7 (M1/70, eBiosciences), streptavidin-PECy (eBiosciences), CD4-PerCPCy5.5 (RM4-5, BioLegend), CD45.2-PerCPCy5.5 (104, BD Bioscience), CD3-Pacific Blue (HIT2, BD Pharmingen). For human PBMCs: CD19-BV650 (HIB19, BioLegend), HLA-DR-BV510 (L243, BioLegend), CD24-BV605 (ML5, BioLegend), CD56-PECy7 (NCAM16.2, BD Pharmingen), CD14-PerCP (MΦP9, BD Pharmingen), IgD-BV510 (IA6-2, BioLegend), CD123-PE (7G3, BD Pharmingen), CD21-APC (B-ly4, BD Pharmingen), CD11c-APC (B-ly6, BD Pharmingen), CD16-APC-H7 (3G8, BD Pharmingen), IgG-PECy7 (G18-145, BD Pharmingen), CD10-PE-CF594 (HI10a, BD Pharmingen), IgA-PE (IS11-8E10, Miltenyi Biotech), CD27-APC-EF-780 (O323, eBiosciences), IgM-EF450 (SA-DA4, eBiosciences), CD38-PerCP-Cy5.5 (A60792, Beckman Coulter), CD93-PECy7 (AA4.1, BioLegend), MyD88 (OTI2B2, ThermoFisher Scientific), TLR7-PE (4G6, Novus Biologicals). Unconjugated antibodies were labeled using the Zip Alexa Fluor 647 Rapid Antibody Labeling Kit (Z11235) as per the manufacturer’s instructions (ThermoFisher Scientific). Zombie aqua dye (BioLegend) or live dead fixable green (Thermo Fisher Scientific) was used for detecting dead cells. Cell Fc receptors were blocked using purified rat anti-mouse CD16/CD32 (Mouse BD Fc Block, BD Biosciences) and then stained for 30 min at 4 °C, in the dark, with primary and secondary antibodies. Intracellular staining was performed using the FOXP3 Transcription Factor Staining Buffer Set (eBioscience) according to the manufacturer’s instructions. Samples were acquired on the Fortessa or Fortessa X-20 cytometer with FACSDiva (BD, Biosciences) and analysed using FlowJo v.10 (FlowJo). All fluorescence-activated cell sorting (FACS) and microscopy analysis was carried out at the Microscopy and Cytometry Facility, Australian National University.

Sanger sequencing

Primers for human TLR7 DNA sequencing were used at 10 µM (primer sequences available on request). PCR amplification was carried out using Phusion Hot Start II DNA Polymerase II (Thermo Fisher Scientific) and under the conditions recommended by the manufacturer. PCR amplicons were electrophoresed and excised bands were purified using the QIAquick Gel Extraction Kit (Qiagen). Sanger sequencing was completed using Big Dye Terminator Cycle sequencing kit v3.1 (Applied Biosystems) using the same primers used for PCR amplification. Sequencing reactions were run on the 3730 DNA Analyze (Applied Biosystems) system at the ACRF Biomolecular Resource Facility, Australian National University.

Immunohistochemistry

Liver, pancreas and kidneys were fixed in 10% neutral buffer formalin solution, embedded in paraffin and stained with H&E.

Bone marrow chimera experimentation

For competitive bone marrow chimeras, Rag1^−/− mice were irradiated and injected intravenously with equal numbers of bone marrow cells from either wild-type or kika CD45.2 and wild-type CD45.1 mice. Mice were given Bactrim in their drinking water for 48 h before injection and for 6 weeks after injection, and housed in sterile cages. After 22 weeks of reconstitution, mice were taken down for phenotyping by flow cytometry.

B cell culture and Cell Trace Violet staining

Single-cell suspensions were prepared from kika, wild-type or Tlr7-knockout mouse spleens. B cells were magnetically purified using the mouse B Cell Isolation Kit (Miltenyi Biotec), labelled with Cell Trace Violet (CTV, Thermo Fisher Scientific) and cultured for 72 h in complete RPMI 1640 medium (Sigma-Aldrich) supplemented with 2 mM l-glutamine (Gibco), 100 U penicillin–streptomycin (Gibco), 0.1 mM non-essential amino acids (Gibco), 100 mM HEPES (Gibco), 55 mM β-mercaptoethanol (Gibco) and 10% FBS (Gibco) at 37 °C in 5% CO₂. For BCR stimulation, cells were cultured in 10 µg ml⁻¹ AffiniPure F(ab′)₂ fragment goat anti-mouse IgM, µ-chain specific (Jackson Immuno Research) or 1 µg ml⁻¹ each R837 (Invitrogen). CD93 expression was examined by sorting splenic B cells with CD19-PE (6D5, BioLegend), CD3-APCCy7 (17A2, BioLegend), CD93-APC (AA4.1, Invitrogen) and the viability stain 7-aminoactinomycin D (Molecular Probes, Invitrogen). Cells were cultured with complete RPMI for 72 h and stimulated with anti-mouse IgM or R837. Bone marrow was obtained from mice. The Fc receptors were blocked (purified rat anti-mouse CD16/CD32 (Mouse BD Fc Block BD Biosciences) and the cells were stained and sorted with B220-PE (RA3-6B2, BioLegend), CD93-APC (AA4.1, Invitrogen) and the viability stain 7-aminoactinomycin D (Molecular Probes, Invitrogen). Cells were sorted on a FACS Aria II system and cultured in complete RPMI medium.

BMDM cell culture and stimulation

Primary BMDMs from 3 Tlr7^kik/Y mice and wild-type littermates were extracted and differentiated for 7 days in complete DMEM supplemented with L929-conditioned medium as previously reported⁴⁷, before overnight stimulation with ssRNA, guanosine or R848. Noticeably, the yield of Tlr7^kik/Y BMDMs obtained after 7 day differentiation was substantially greater than from wild-type mice. All synthetic RNAs were synthesized by Integrated DNA Technologies. ssRNAs (below) with no backbone modification were resuspended in duplex buffer (100 mM potassium acetate, 30 mM HEPES, pH 7.5, DNase–RNase-free H₂O), and were previously shown to induce TLR7 sensing in human cells⁴⁸. ssRNAs were transfected with DOTAP (Roche) and pure DMEM in biological triplicate, as previously described⁴⁸, to a final concentration of 500 nM. The ratio of DOTAP to RNA (at 80 μM) was 3.52 µg μl⁻¹ of ssRNA. Guanosine (Sigma-Aldrich, G6264, 10 mg freshly resuspended in 176.5 μl DMSO (200 mM stock solution)) and R848 (Invivogen, tlrl-r848) were used at the indicated final concentrations. TNF levels in culture supernatants were detected using the BD OptEIA Mouse ELISA kit (BD Biosciences) according to the manufacturers’ protocols. Tetramethylbenzidine substrate (Thermo Fisher Scientific) was used for quantification of the cytokines on a Fluostar OPTIMA (BMG LABTECH) plate-reader. The RNA sequences used (5′-3′) were as follows: B-406AS-1, UAAUUGGCGUCUGGCCUUCUU; 41-L, GCCGGACAGAAGAGAGACGC; 41-6, GCCGGACAUUAUUUAUACGC; 41-8, GCCGGUCUUUAUUUAUACGC; 41-10, GCCGGUCUUUUUUUUUACGC.

ADVIA blood analysis

Orbital bleeds were performed on mice and blood samples were run on the ADVIA system (Siemens Advia 1200).

Western blotting

Cytosolic extracts were prepared from around 20 million–40 million splenocytes by lysis in Triton X-100 buffer (0.5% Triton X-100, 20 mM Tris-HCl pH 7.4, 150 mM NaCl, 1 mM EDTA, 10% glycerol) and centrifuged. Cytosolic extracts were resolved on 8% SDS–polyacrylamide gels and probed with the relevant primary and secondary antibodies. Rabbit anti-TLR7 (D7; Cell Signaling Technology) and mouse anti-mouse TLR7-PE (A94B10; BD Biosciences) were used at 1:1,000, the actin monoclonal antibody (JLA20, Developmental Studies Hybridoma Bank, The University of Iowa) was used at 1:5,000. Membranes were developed with Clarity Western ECL Substrate (BioRad Laboratories).

Dual-luciferase assays

RAW264.7 cells were transfected with 245 ng of pNIFTY (NF-κB luciferase; InvivoGen), pRL-CMV (100 ng, Promega) Renilla luciferase control plasmid, 125 ng of TLR7-HA plasmids (Genecopoeia) expressing the individual variants. After overnight expression, half of the samples were stimulated with 1 mM 2′,3′-cGMP (Santa Cruz) or 1 mM guanosine plus 20 µg ml⁻¹ ssRNA using DOTAP for 6 h and dual-luciferase assays were performed as previously described⁴⁵. Raw264.7 cells (originally from ATCC) were tested for mycoplasma contamination using PlasmoTest (InvivoGen).

Statistics

Statistical analysis was carried out using R software v.3.6.1 (The R Foundation for Statistical Computing) and the Emmeans package. Mouse spleen mass data were analysed using two experiments as a blocking factor and one-way ANOVA, followed by a pairwise estimated marginal means comparison of genotypes. Mouse cellular phenotyping, ELISAs, white blood cell and platelet count analyses were performed using a log linear regression model and one-way ANOVA, followed by a pairwise estimated marginal means comparison of genotypes. Purified B cell cultures were analysed using a linear regression model and one-way ANOVA, followed by a pairwise estimated marginal means comparison of genotypes and stimulatory effect. Luciferase assay statistics were analysed using one-way ANOVA with Bonferroni multiple-comparison test (Prism, GraphPad). All data were filed using Microsoft Excel 2016 and graphed using PRISM.

DNA, RNA and nRNP ELISAs

Plates were coated with poly-l-lysine (Sigma-Aldrich) before addition of 2.5 µg of either DNA (D7290, Sigma-Aldrich), RNA (AM7120G, Thermo Fisher Scientific) or nRNP (SRC-1000, Immunovision). Plates were then blocked in ELISA blocking buffer (PBS and 1% BSA) for 2 h at room temperature. Mouse serum was diluted 1:40 with ELISA coating buffer (0.05 M sodium carbonate anhydrous/sodium hydrogen carbonate, pH 9.6), and incubated in the ELISA plates overnight at 4 °C. The plates were washed and goat anti-mouse IgG-AP antibodies (Alkaline Phosphatase, Southern Biotech) were added for 1 h at 37 °C. Phosphatase substrate (Sigma-Aldrich, S0942) was used as described by the manufacturer. The samples were read using the Infinite 200 PRO Tecan Microplate Reader (Tecan Group) at an absorbance of 405 nm and normalized to background absorbance at 605 nm.

Hep-2/C. luciliae immunofluorescence

ANAs and dsDNA were determined using Hep-2 and Crithidia luciliae slides (both from NOVA Lite), respectively. Serum was diluted 1:40 for Hep-2 slides and 1:20 for Crithidia slides and stained as described by the manufacturer using donkey anti-mouse IgG Alexa-488 (Molecular Probes) as the secondary antibody. The slides were imaged using an Olympus IX71 inverted fluorescence microscope.

RNA-seq analysis

Total B cells were obtained from wild-type or kika mouse spleens and purified using the Mouse B Cell Isolation Kit (Miltenyi Biotec) and stimulated with anti-mouse IgM (10 µg ml⁻¹) for 20 h. Total RNA was extracted using RNeasy Mini Kits (74104, Qiagen). Sequencing was performed using the NextSeq500 platform and analysis was conducted using the following R packages: limma, edgeR and enhanced volcano⁴⁹. For the patient, type I IFN single-cell RNA-seq analysis was performed. PBMCs were isolated from frozen human samples as previously described⁵⁰. Live cells were next purified by FACS using 7AAD and labelled with TotalSeq anti-human hashtags (BioLegend). The number of cells was determined and 10,000 cells per sample were run on the 10x Chromium platform (10x Genomics). Library preparation and sequencing were performed by The Biomedical Research Facility according to the manufacturer’s instructions for the Chromium Next GEM Single Cell 5′ Kit v2. The samples were sequenced using the NovaSeq 6000 (Illumina) system. The FASTQ files were aligned to the human GRCh38 reference genome using 10x Genomics Cell Ranger pipeline v.6.0.1. Statistical analysis, clustering and visualization were conducted using Seurat v.4.0.1 in the R environment.

Molecular dynamics simulations

Details of the computational modelling are provided in the Supplementary Methods.

Reporting summary

Further information on research design is available in the Nature Research Reporting Summary linked to this paper.